Permalink
Name already in use
A tag already exists with the provided branch name. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Are you sure you want to create this branch?
mirpipe/WORKFLOW
Go to fileThis commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
272 lines (228 sloc)
12 KB
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
WORKFLOW | |
--- | |
The user can upload either FASTQ or FASTA files bearing reads using the | |
web interface or the MIRPIPE FTP server. These should ideally be | |
compressed (.zip, .gz) to reduce upload time. The pipeline can fully | |
process raw reads originating from Illumina, 454, IonTorrent or Sanger | |
sequencing instruments including adapter trimming. | |
--- Parameters: | |
- Reads: File bearing reads in FASTQ or FASTA format (ideally zip | |
compressed for Galaxy). This file can either be uploaded using the Galaxy | |
Upload Tool (Helpful Tools / Get Data / Upload Files) or using an account | |
on our FTP server. The latter is only possible after the registration of a | |
user in Galaxy, which automatically creates an account with the same | |
username and password on the FTP server | |
(ftp://bioinformatics.mpi-bn.mpg.de/). The data will be deleted from the | |
server after two weeks. | |
A reference FASTA database bearing mature target miRNAs can either be | |
selected from the preprocessed current miRBase release 20 data harbouring | |
30424 entries of 206 species or can be uploaded by the user in FASTA | |
format. The user can optionally choose a subset of the miRBase reference | |
miRNAs bearing only miRNAs of the desired organism to limit the comparison | |
the e.g. the closest relative. If the chosen reference FASTA file does not | |
obey to the naming convention of miRBase (<species>-miR-<#>-<suffix>), the | |
"family name clustering" parameter should be turned off. | |
--- Parameters: | |
- Reference database: Preprocessed DBs (full miRBase or miRNAs of only one | |
species) or any user uploaded FASTA file bearing mature miRNAs. The | |
correct miRBase file can be downloaded for offline usage: | |
ftp://mirbase.org/pub/mirbase/CURRENT/mature.fa.gz. | |
The raw read data is then processed to optionally remove an adapter | |
sequence and trim for a minimum quality (default Q20). Only reads of the | |
desired size range are selected to limit the pool to likely mature miRNAs | |
(default: 18-28 nt). | |
--- Parameters: | |
- Adapter sequence: Nucleotide sequence of the adapter to be removed from | |
the 3' end using Cutadapt. By default the larger of the following values | |
is used as the maximum mismatch number: 1, 10% of the adapter length. | |
These values can be changed inside the mirpipe.pl script. | |
- Minimum read length: Minimum length of a read after trimming to be | |
considered in the analysis. | |
- Minimum base quality: Minimum phred quality for FASTQ data. Nucleotides | |
with lower quality will be trimmed. This parameter is not used if FASTA | |
formatted read data is supplied. | |
- Maximum read length: Maximum length of a read to be considered in | |
analysis. | |
Duplicate reads are collapsed to decrease the number of necessary homology | |
searches (the number of duplicates per read is noted). Only those | |
sequences present a minimum number of times (default = 5) are kept for | |
further analyses. This measure is intended to remove unique reads which | |
frequently denote sequencing errors or lowly expressed miRNAs that can not | |
be reliably quantified. Setting this parameter to "1" will increase | |
sensitivity at the cost of an increased false positive rate. | |
--- Parameters: | |
- Minimum read copy number: A read sequence must be present at least this | |
number of times to be included. | |
Read counts from isomiRs of the same miRNA are combined. These isomiR read | |
sequences may only differ by the 3' end and are thus putatively encoded by | |
the same gene and bear the same target specificity. This function allows | |
the summary of putatively functionally equivalent isomiRs resulting from | |
imperfect digestion by the RNases Drosha and Dicer or RNA-Editing by | |
specialized enzymes resulting in 3' modification. Only the final 3' | |
nucleotide may differ between two sequences to be counted as isoforms of | |
the same miRNA and only the longest isoform sequence is used in the next | |
step to reduce the amount of homology searches per miRNA. | |
The resulting read sequences are compared versus the chosen reference | |
database of miRNAs. Sensitivity and specificity of this BLASTN homology | |
search can be controlled using various parameters. Parameters are | |
optimized for small query sequences (-num_alignments 15 -word_size 7 | |
-evalue 10 -dust no -strand plus). The resulting hits are filtered to | |
exclude those with too many mismatches ((read length - alignment length) + | |
mismatches + gaps = final mismatches). | |
--- Parameters: | |
- Maximum mismatches: Maximum number of mismatches allowed between | |
reference miRNA and read sequence ((read length - alignment length) + | |
mismatches + gaps = final mismatches). This parameter controls the size of | |
the miRNA clusters: more mismatches allowed = larger clusters. | |
Mature miRNAs and their precursors are optionally collated by name on the | |
family level to remove redundancy (ex. | |
bta-miR-200a,oan-miR-200a-3p,tgu-miR-200a-3p -> miR-200a). Otherwise the | |
complete miRNA names given in the reference database are carried over | |
resulting in more detailed but also more redundant output. Turning off the | |
family name clustering can be advisable in case the reference database of | |
miRNA sequences does not obey to the naming convention of miRBase | |
(<species>-miR-<#>-<suffix>). | |
--- Parameters: | |
Family name clustering: Collapse the names of all variants of a miRNA to | |
the miRNA family (ex. bta-miR-200a,oan-miR-200a-3p,tgu-miR-200a-3p -> | |
miR-200a). | |
Detected reference miRNA families per read are scored based on the minimum | |
number of mismatches. If a read matched equally well versus multiple miRNA | |
families, the respective families are joined by single linkage clustering. | |
By default only those read sequences that are at least 5% as abundant as | |
the most abundant sequence per miRNA family cluster are denoted (ex. most | |
abundant sequence = 100 reads, cutoff = 5 reads). This is intended to | |
further suppress reads resulting from sequencing errors or biological | |
miRNA variations that are expressed near the detection limit. | |
--- Parameters: | |
Minimum cluster abundance: Remove read sequences from a cluster that are | |
less than x% as abundant as the most abundant sequence. This is intended | |
to suppress reads resulting from sequencing errors or biological miRNA | |
variations that are expressed near the detection limit. This parameter | |
controls the size of the miRNA clusters: lower minimum cluster abundance = | |
larger clusters. | |
In order to achieve congruent results yielding one count value per miRNA, | |
miRNA family clusters are finally split. Since some of the reads match | |
multiple miRNAs equally well, these reads are counted fully for all of the | |
respective miRNAs. This can lead to a situation where the summarized read | |
counts of all miRNAs can be higher than the amount of reads totally | |
matching. Each miRNA is associated with an ambiguity value, denoting the | |
share of reads that could not be placed clearly (e.g. 11/89 reads | |
ambiguous = 0.12). If this value is high, the respective miRNA count may | |
be misleading. Finally, the most abundant sequence matching a miRNA is | |
given (primary sequence) as well as the number of reads matching it. | |
OUTPUT FILES | |
--- | |
- 1. mirpipe_cluster.tsv: MIRPIPE miRNA clusters = output of one read | |
sequence per line | |
This file is centred on the different read sequences found per miRNA | |
cluster that result from biological and technical variation. Only those | |
read sequences that are >=5% as abundant as the most abundant sequence per | |
cluster are denoted by default. If a read matched equally well versus | |
multiple miRNAs, the respective miRNAs or miRNA clusters are joined by | |
single linkage clustering. | |
Columns: | |
Cluster Cluster number | |
Sequence Read sequence | |
Count Summarized read count for all duplicates of this read | |
miRNA Name of miRNA or miRNA families | |
Example (sorted for cluster number, expression): | |
Cluster Sequence Count miRNA | |
90 CAGTACTGTGATAACTGAAGAA 33 miR-101a | |
90 CTACTGTGATAACTGACT 17 miR-101c,miR-101a | |
- 2. mirpipe_cluster.fasta: MIRPIPE cluster sequences | |
All sequences reported in the MIRPIPE miRNA cluster's file in fasta format. | |
Example: | |
>miR-101a count=33 | |
CAGTACTGTGATAACTGAAGAA | |
>miR-101a,miR-101c count=17 | |
GTACTGTGATAACTGACT | |
- 3. mirpipe_mirna.tsv: MIRPIPE miRNAs on 5% level = output of one miRNA | |
per line | |
This file includes one count value per miRNA and can directly serve as | |
input for subsequent differential expression analyses. It is based on | |
clusters of highly similar miRNAs, where a clear assignment of reads is | |
not always possible, since the same read can match equally well to | |
multiple reference miRNAs. Only those miRNA sequences are reported that | |
are >5% as abundant as the most abundant sequence in its cluster. | |
Columns: | |
miRNA Name of miRNA or miRNA family | |
Count Summarized read count including isomiRs, | |
biological + technical sequence variations | |
Ambiguous reads Ratio of reads that mapped equally well to other | |
miRNAs inside the miRNA family cluster | |
Cluster miRNA family cluster number | |
Primary sequence Most abundant sequence for this miRNA inside the | |
cluster | |
Primary sequence count Count of the most abundant sequence for this miRNA | |
inside the cluster | |
Cluster members A comma-separated list of all members of the miRNA | |
family cluster | |
Example (sorted for cluster number, expression): | |
miRNA Expression Ambiguity Cluster Primary Sequence PS Count | |
Cluster members | |
miR-101a 143 0.12 90 CAGTACTGTGATAACTGAAGAA 33 | |
miR-101a,miR-101c | |
miR-101c 17 1 90 GTACTGTGATAACTGACT 17 | |
miR-101a,miR-101c | |
EXAMPLE | |
--- | |
The following example shows a MIRPIPE result using default parameters. Two | |
miRNAs (miR-2478,miR-3968) were joined into a miRNA cluster based on | |
BLASTN results. | |
mirpipe_cluster.tsv | |
Cluster Sequence Count miRNA | |
192 ATCCCACTTCTGACACCA 69 miR-2478 | |
192 ATCCCACTCTCAACACCA 11 miR-3968 | |
192 ATCCCACTCCTGACACCA 11 miR-2478,miR-3968 | |
192 ATCCCATTCTTGACACCA 9 miR-2478 | |
192 TCGAATCCCACTCCTGACACCA 6 miR-3968 | |
192 AATCCCACTCTCAACACCA 5 miR-3968 | |
192 TCAAATCCCACTCTCAACACCA 5 miR-3968 | |
mirpipe_cluster.fasta: | |
>miR-2478 count=69 | |
ATCCCACTTCTGACACCA | |
>miR-3968 count=5 | |
AATCCCACTCTCAACACCA | |
>miR-3968 count=11 | |
ATCCCACTCTCAACACCA | |
>miR-2478,miR-3968 count=11 | |
ATCCCACTCCTGACACCA | |
>miR-2478 count=9 | |
ATCCCATTCTTGACACCA | |
>miR-3968 count=5 | |
TCAAATCCCACTCTCAACACCA | |
>miR-3968 count=6 | |
TCGAATCCCACTCCTGACACCA | |
mirpipe_mirna.tsv: | |
miRNA Count Ambiguity Cluster Primary Sequence Primary | |
Sequence Reads Cluster members | |
miR-2478 89 0.12 192 ATCCCACTTCTGACACCA 69 | |
miR-2478,miR-3968 | |
miR-3968 38 0.29 192 ATCCCACTCTCAACACCA 11 | |
miR-2478,miR-3968 | |
The mirpipe_cluster.tsv file depicts the best BLASTN hit per read sequence | |
based on the least number of mismatches. Sequences are sorted for | |
expression from top to bottom with the least expressed sequence still at | |
least 5% as abundant as the most expressed sequence (69 <> 5). The two | |
miRNAs were joined to a cluster because one of the read sequences showed a | |
BLASTN hit which fit equally well to both reference sequences (192 | |
ATCCCACTCCTGACACCA 11 miR-2478,miR-3968). If another query had | |
found that e.g. miR-2478 and miR-1000 had resulted in equally similar | |
homologies, the two clusters would have been joined to | |
miR-2478,miR-3968,miR-1000. | |
The mirpipe_cluster.fasta file shows all read sequences found in | |
mirpipe_cluster.tsv converted to FASTA format. | |
The mirpipe_mirna.tsv file attempts to include one count value per miRNA | |
in order to facilitate later quantification. The count values for each | |
sequence detected per miRNA are summarized (e.g.: miR-2478 = 69 + 11 + 9 = | |
89, miR-3968 = 11 + 11 + 6 + 5 + 5 = 38). Since some of the reads matched | |
two different miRNAs equally well (miR-2478,miR-3968 = 11), these reads | |
are counted fully for both miRNAs. This leads to a situation where the | |
summarized read counts of all miRNAs can be higher than the amount of | |
reads totally matching. Each miRNA is associated with an ambiguity value, | |
denoting the share of reads that could not be placed clearly (e.g. | |
miR-2478: 11/89 ambiguous = 0.12). If this value is high, the respective | |
miRNA count may be misleading. Finally, the most abundant sequence | |
matching a miRNA is given (primary sequence) as well as the number of | |
reads matching it. |