Update HELP.md

Input tables
loosolab · Jul 7, 2015 · 791acf5 · 791acf5
1 parent a7fcb2c
commit 791acf5
Showing 1 changed file with 77 additions and 93 deletions.
diff --git a/HELP.md b/HELP.md
@@ -49,7 +49,7 @@ The input (grey) is composed of an optional list of miRNAs and an optional annot
 - **B** Next, all target gene symbols of the selected MTIs are mapped to UniProtAccs, while
 - **C** all UniProtAccs are filtered from the annotation file simultaneously.
 - **D** Subsequently, both lists are overlapped, resulting in those MTIs which can be linked to the submitted data.
-In case of a missing annotation file, steps (C) and (D) are ignored, and the resulting MTIs rely on the miRNA list or just on the adjustable properties.
+In case of a missing annotation file, steps **C** and **D** are ignored, and the resulting MTIs rely on the miRNA list or just on the adjustable properties.
 - **E** As an option, an enrichment analysis of the identified MTI sets is realized by submitting a ranked list with UniProtAccs. The analysis is based on the R implementation of GSEA (Subramanian, et al., 2005).
 
 ### Parameters
@@ -75,91 +75,75 @@ Parameter | Explanation
 
 **Annotation File (-ia)**
 
-	File type:			Tab delimited
-	Header:				No
-	Required Content:	UniProt accessions per line or separated by comma.
-	Allowed Content:	Several columns; Empty content; Accessions with attached information concerning, for example, the underlying database, delimited by a pipe (  | ) symbol (e.g. sp|Q9XS59|S6A15_BOVIN).
-						At this, only this identifier will be saved, which occurs after the first pipe symbol (e.g. sp|Q9XS59|S6A15_BOVIN > Q9XS59). Identifiers from other databases are ignored.
-	Example "Required":
-		+--------------------+
-		|A2A6A1              |
-		+--------------------+
-		|O88898,P54763,Q3UHC0|
-		+--------------------+
-		|G5E870              |
-		+--------------------+
-		|Q6A037              |
-		+--------------------+
-
-	Example "Allowed":
-		+-------------------+-------+-----------------------------------------+
-		|comp1000309_c0_seq1|slc15a3|Q8IY34,O75618                            |
-		+-------------------+-------+-----------------------------------------+
-		|comp1000318_c0_seq1|       |                                         |
-		+-------------------+-------+-----------------------------------------+
-		|comp1000627_c0_seq1|slc6a15|sp|Q9XS59|S6A15_BOVIN                    |
-		+-------------------+-------+-----------------------------------------+
-		|comp1000899_c0_seq1|       |gb|CX212397.1,dbj|DB530926.2,gi|154363325|
-		+-------------------+-------+-----------------------------------------+
+- *File type*:		Tab delimited
+- *Header*:		No
+- *Required Content*:	UniProt accessions per line or separated by comma.
+- *Allowed Content*:	Several columns; Empty content; Accessions with attached information concerning, for example, the underlying database, delimited by a pipe ( | ) symbol (e.g. sp|Q9XS59|S6A15_BOVIN). At this, only this identifier will be saved, which occurs after the first pipe symbol (e.g. sp|Q9XS59|S6A15_BOVIN > Q9XS59). Identifiers from other databases are ignored.
+
+Example "Required":
+
+    |
+----|
+A2A6A1 |       
+O88898,P54763,Q3UHC0 |
+G5E870 |
+Q6A037 |
 
+Example "Allowed":
+
+   |  |   |
+-------------------|-------|-----------------------------------------|
+comp1000309_c0_seq1|slc15a3|Q8IY34,O75618                            |
+comp1000318_c0_seq1|       |                                         |
+comp1000627_c0_seq1|slc6a15|sp|Q9XS59|S6A15_BOVIN                    |
+comp1000899_c0_seq1|       |gb|CX212397.1,dbj|DB530926.2,gi|154363325|
 
 
 **miRNA File (-im)**
 
-	File type: 			Tab delimited
-	Header: 			No
-	Required Content: 	One mature miRNA identifier (e.g. hsa-miR-17a-5p) per line in column 1.
-	Allowed Content: 	Several columns and shortened miRNA identifiers.
-						Shortened miRNA identifiers have to consist at least of the prefix miR, lin or let, the identification number and, if existent,
-						the lettered suffix showing sequence similarity (e.g miR-17a).
-
-	Example "Required":
-		+-------+
-		|miR-93b|
-		+-------+
-		|miR-36f|
-		+-------+
-		|miR-29d|
-		+-------+
-		|miR-29c|
-		+-------+
-
-	Example "Allowed":
-	The example is a part of an original output of the MIRPIPE pipeline, which the parameters are adjusted to.
-		+-------+------+----+---+----------------------+------+
-		|miR-93b|52    |1.00|170|CAAGTGCTGTTCGTGCAGGTAG|33    |
-		+-------+------+----+---+----------------------+------+
-		|miR-36f|211   |0.00|171|ATTGAGCTATCTGTGTAG    |211   |
-		+-------+------+----+---+----------------------+------+
-		|miR-29d|141233|0.02|172|TAGCACCATATGAAATCAGTGT|133582|
-		+-------+------+----+---+----------------------+------+
-		|miR-29c|55690 |1.00|172|TAGCACCATTTGAAATCGGTTA|44200 |
-		+-------+------+----+---+----------------------+------+
+- *File type*: 		Tab delimited
+- *Header*: 		No
+- *Required Content*: 	One mature miRNA identifier (e.g. hsa-miR-17a-5p) per line in column 1.
+- *Allowed Content*: 	Several columns and shortened miRNA identifiers. Shortened miRNA identifiers have to consist at least of the prefix miR, lin or let, the identification number and, if existent, the lettered suffix showing sequence similarity (e.g miR-17a).
+
+Example "Required":
+
+   |
+-------|
+hsa-miR-93b-5p|
+miR-36f|
+mmu-miR-29d-3p|
+miR-29c|
+
+Example "Allowed":
+The example is a part of an original output of the MIRPIPE pipeline (Kuenne et al., 2014), which the LimiTT parameters are adjusted to.
+
+  | | | | | |
+-------|------|----|---|----------------------|------|
+miR-93b|52    |1.00|170|CAAGTGCTGTTCGTGCAGGTAG|33    |
+miR-36f|211   |0.00|171|ATTGAGCTATCTGTGTAG    |211   |
+miR-29d|141233|0.02|172|TAGCACCATATGAAATCAGTGT|133582|
+miR-29c|55690 |1.00|172|TAGCACCATTTGAAATCGGTTA|44200 |
 
 
 
 **Ranking File (-ir)**
 
-	File type: 			Tab delimited
-	Header: 			No
-	Required Content: 	UniProt accessions in column one, corresponding ranking value in column two.
-	Allowed Content: 	The content must not be sorted by the ranking values.
+- *File type*: 		Tab delimited
+- *Header*: 		No
+- *Required Content*: 	UniProt accessions in column one, corresponding ranking value in column two.
+- *Allowed Content*: 	The content must not be sorted by the ranking values.
 
-	Example:
-		+------+-----------+
-		|A2A6A1|0.152108244|
-		+------+-----------+
-		|P54763|0.640846805|
-		+------+-----------+
-		|Q3UHC0|0.931454837|
-		+------+-----------+
-		|O88898|0.240325584|
-		+------+-----------+
-		|G5E870|0.47554716 |
-		+------+-----------+
-		|Q6A037|0.495874819|
-		+------+-----------+
+Example:
 
+ | |
+------|-----------|
+A2A6A1|0.152108244|
+P54763|0.640846805|
+Q3UHC0|0.931454837|
+O88898|0.240325584|
+G5E870|0.47554716 |
+Q6A037|0.495874819|
 
 ### Output
 
@@ -177,19 +161,19 @@ Parameter | Explanation
 	The order of the DBs for the binary string can be found in the first row.
 
 	Example:
-		+--------------------------------------------------------+
+		|--------------------------------------------------------|
 		|Database order: TarBase, miRTarBase, miRecords, starBase|
-		+------+-----+-------+------+-------+------+-------------+
+		|------|-----|-------|------|-------|------|-------------|
 		|      |miR-9|miR-15a|miR-17|miR-19b|miR-24| miR-26a     |
-		+------+-----+-------+------+-------+------+-------------+
+		|------|-----|-------|------|-------|------|-------------|
 		|A0AVK6| 0001|       |      |       |  0110|             |
-		+------+-----+-------+------+-------+------+-------------+
+		|------|-----|-------|------|-------|------|-------------|
 		|A2A6A1|     |       |      |   1110|      |             |
-		+------+-----+-------+------+-------+------+-------------+
+		|------|-----|-------|------|-------|------|-------------|
 		|A2AAY5|     |       |  1110|       |      | 1001        |
-		+------+-----+-------+------+-------+------+-------------+
+		|------|-----|-------|------|-------|------|-------------|
 		|A2AHG0|     |0001   |  0101|       |      |             |
-		+------+-----+-------+------+-------+------+-------------+
+		|------|-----|-------|------|-------|------|-------------|
 
 		
 **MTI Info**
@@ -231,13 +215,13 @@ Parameter | Explanation
 	and the index within the ranked gene file at which the running sum statistic calculated the maximal ES. 
 
 	Example:
-		+--------+----+----+----+---------+-----------+------------------------------+
+		|--------|----|----|----|---------|-----------|------------------------------|
 		|MTI Set |Size|ES  |NES |FDR q-val|Rank at Max|Leading Edge                  |
-		+========+====+====+====+=========+===========+==============================+
+		|========|====|====|====|=========|===========|==============================|
 		|miR-149 | 6  |0.65|1.55|0.290    | 16        |tags=67%, list=29%, signal=53%|
-		+--------+----+----+----+---------+-----------+------------------------------+
+		|--------|----|----|----|---------|-----------|------------------------------|
 		|miR-301b| 4  |0.61|1.29|0.790    | 1         |tags=25%, list=2%, signal=26% |
-		+--------+----+----+----+---------+-----------+------------------------------+
+		|--------|----|----|----|---------|-----------|------------------------------|
 
 
 **EnrichmentScore Plots**
@@ -253,21 +237,21 @@ Parameter | Explanation
 	the running ES for this target and whether it is a member of the leading edge set or not.
 
 	Example:
-		+--------+------+--------------------+----------+---------+
+		|--------|------|--------------------|----------|---------|
 		|MTI set |Target|Index in Ranked List|Running ES|LE Member|
-		+========+======+====================+==========+=========+
+		|========|======|====================|==========|=========|
 		|miR-149 |Q9WV91| 10                 |0.06      |Yes      |
-		+--------+------+--------------------+----------+---------+
+		|--------|------|--------------------|----------|---------|
 		|miR-149 |Q80SW1| 13                 |0.24      |Yes      |
-		+--------+------+--------------------+----------+---------+
+		|--------|------|--------------------|----------|---------|
 		|miR-149 |Q71B07| 15                 |0.44      |Yes      |
-		+--------+------+--------------------+----------+---------+
+		|--------|------|--------------------|----------|---------|
 		|miR-181a|Q56A04| 29                 |-0.16     |Yes      |
-		+--------+------+--------------------+----------+---------+
+		|--------|------|--------------------|----------|---------|
 		|miR-181a|A2AJK6| 36                 |0.38      |Yes      |
-		+--------+------+--------------------+----------+---------+
+		|--------|------|--------------------|----------|---------|
 		|miR-190a|A3KGB4| 14                 |0.76      |Yes      |
-		+--------+------+--------------------+----------+---------+
+		|--------|------|--------------------|----------|---------|